Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659451

gRNA Name: rspo2 gRNA2
Synonyms: trop rspo2 T2
Genomic Target: rspo2

PAM Sequence: TGG
Sequence: 5' AGAGAAGGTATGAGGCAGTATGG 3'



Genomic Target tropicalis laevis.L
Identities 23/23 23/23
genome
gRNA
5' CCATACTGCCTCATACCTTCTCT 3'
   |||||||||||||||||||||||
3' GGTATGACGGAGTATGGAAGAGA 5'
5' CCATACTGCCTCATACCTTCTCT 3'
   |||||||||||||||||||||||
3' GGTATGACGGAGTATGGAAGAGA 5'
    
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr6L:135149264..135149286 23/23 Antisense target rspo2.L
chr9_10L:42056878..42056900 20/23 Antisense off-target LOC108701186 [provisional:trim25]
chr9_10S:44684138..44684160 19/23 Antisense off-target igfbp2.S
chr8L:6335700..6335722 19/23 Sense off-target dab2ip-like.L
Scaffold7786:832..854 21/23 Sense unknown
chr2S:116472417..116472439 19/23 Sense unknown
chr2S:36069762..36069784 19/23 Antisense unknown
tropicalis 10.0 Chr6:133578319..133578341 23/23 Antisense target rspo2
Publications
First:
Most recent:
View All Papers