Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659450

gRNA Name: ror2 gRNA2
Synonyms: trop ror2 T6
Genomic Target: ror2

Sequence: 5' AGCCCAAGAGAATTACCATCAGG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 23/23 22/23 23/23
genome
gRNA
5' CCTGATGGTAATTCTCTTGGGCT 3'
   |||||||||||||||||||||||
3' GGACTACCATTAAGAGAACCCGA 5'
5' CCTAATGGTAATTCTCTTGGGCT 3'
   ||| |||||||||||||||||||
3' GGACTACCATTAAGAGAACCCGA 5'
5' CCTGATGGTAATTCTCTTGGGCT 3'
   |||||||||||||||||||||||
3' GGACTACCATTAAGAGAACCCGA 5'
   
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr1S:114177329..114177351 23/23 Antisense target ror2.S
chr1L:137156100..137156122 22/23 Antisense target ror2.L
chr1L:160307103..160307125 19/23 Antisense off-target LOC108716396 [provisional:tmem132b]
chr7S:77972219..77972241 21/23 Antisense unknown
chr2L:103257043..103257065 19/23 Sense unknown
chr6S:62571513..62571535 19/23 Antisense unknown
tropicalis 10.0 Chr1:138911969..138911991 23/23 Antisense target ror2
Publications
First:
Most recent:
View All Papers