Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659448

gRNA Name: ripply3 gRNA1
Synonyms: trop ripply3 T2
Genomic Target: ripply3

Sequence: 5' CCAACTTCCCAGTCCAAGCCACC 3'



Genomic Target tropicalis laevis.L
Identities 23/23 21/23
genome
gRNA
5' GGTGGCTTGGACTGGGAAGTTGG 3'
   |||||||||||||||||||||||
3' CCACCGAACCTGACCCTTCAACC 5'
5' GGTGGCTTGGACTGGGAAACTGG 3'
   ||||||||||||||||||  |||
3' CCACCGAACCTGACCCTTCAACC 5'
    
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr2L:11872385..11872407 21/23 Antisense target ripply3.L
chr2S:125120285..125120307 20/23 Sense unknown
chr3S:105766861..105766883 20/23 Sense unknown
tropicalis 10.0 Chr2:12661967..12661989 23/23 Antisense target ripply3
Chr1:108508007..108508029 20/23 Sense off-target snx30
Chr2:121470681..121470703 19/23 Sense off-target farp1
Chr4:44055965..44055987 19/23 Antisense unknown
Chr7:122773650..122773672 19/23 Sense unknown
Publications
First:
Most recent:
View All Papers