Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659447

gRNA Name: rfx6 gRNA1
Synonyms: trop rfx6T
Genomic Target: rfx6

PAM Sequence: AGG
Sequence: 5' TGGGCATACAGTATGCATCGAGG 3'



Genomic Target tropicalis laevis.L
Identities 23/23 21/23
genome
gRNA
5' CCTCGATGCATACTGTATGCCCA 3'
   |||||||||||||||||||||||
3' GGAGCTACGTATGACATACGGGT 5'
5' CCTCGATGCATACTCTATGCTCA 3'
   |||||||||||||| ||||| ||
3' GGAGCTACGTATGACATACGGGT 5'
    
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr5L:75534039..75534061 21/23 Sense target rfx6.L
chr8L:84750235..84750257 21/23 Sense off-target fntb.L
chr8L:84750235..84750257 21/23 Sense off-target slc8a3.L
chr4L:26012303..26012325 20/23 Sense off-target atl3.L
chr9_10L:89263409..89263431 19/23 Antisense off-target zc3h7a.L
chr1L:139641984..139642006 19/23 Sense off-target LOC101027262
chr5S:57009809..57009831 21/23 Sense unknown
chr1L:191967751..191967773 20/23 Sense unknown
chr1S:59324612..59324634 19/23 Antisense unknown
chr3L:16248133..16248155 19/23 Antisense unknown
chr5L:107327380..107327402 19/23 Sense unknown
tropicalis 10.0 Chr5:74668842..74668864 23/23 Sense target rfx6
Chr1:125419237..125419259 19/23 Sense unknown
Chr1:71413412..71413434 19/23 Antisense unknown
Chr3:93612194..93612216 19/23 Antisense unknown
Chr5:138353635..138353657 19/23 Antisense unknown
Publications
First:
Most recent:
View All Papers