Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659446

gRNA Name: rflcii gRNA1
Synonyms: trop rflcii T1
Genomic Target: rflcii

PAM Sequence: GGG
Sequence: 5' GGACTGTGGTGATGTCCTGCGGG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 23/23 22/23 22/23
genome
gRNA
5' CCCGCAGGACATCACCACAGTCC 3'
   |||||||||||||||||||||||
3' GGGCGTCCTGTAGTGGTGTCAGG 5'
5' TCCGCAGGACATCACCACAGTCC 3'
    ||||||||||||||||||||||
3' GGGCGTCCTGTAGTGGTGTCAGG 5'
5' CCCACAGGACATCACCACAGTCC 3'
   ||| |||||||||||||||||||
3' GGGCGTCCTGTAGTGGTGTCAGG 5'
   
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 Scaffold21:3200350..3200372 22/23 Antisense target rflcii.S
chr1L:108881513..108881535 22/23 Sense target rflcii.L
chr1L:107014779..107014801 20/23 Antisense unknown
tropicalis 10.0 Chr1:111367613..111367635 23/23 Sense target rflcii
Chr1:151991918..151991940 19/23 Antisense off-target hnf1a
Chr1:151991918..151991940 19/23 Antisense off-target c1h12orf43
Chr4:78361078..78361100 19/23 Antisense unknown
Publications
First:
Most recent:
View All Papers