Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659422

gRNA Name: otx2 gRNA1
Synonyms: trop otx2 T1
Genomic Target: otx2

Sequence: 5' CCAAAACTCGTTACCCCGATATC 3'



Genomic Target tropicalis laevis.S
Identities 23/23 22/23
genome
gRNA
5' GATATCGGGGTAACGAGTTTTGG 3'
   |||||||||||||||||||||||
3' CTATAGCCCCATTGCTCAAAACC 5'
5' GATATCAGGGTAACGAGTTTTGG 3'
   |||||| ||||||||||||||||
3' CTATAGCCCCATTGCTCAAAACC 5'
    
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr8S:6436107..6436129 22/23 Antisense target otx2.S
tropicalis 10.0 Chr8:104118529..104118551 23/23 Sense target otx2
Publications
First:
Most recent:
View All Papers