Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659421

gRNA Name: olig3 gRNA2
Synonyms: laevis olig3 T5
Genomic Target: olig3

PAM Sequence: CGG
Sequence: 5' ATATGGAGGAGGTGTATCTCCGG 3'



Genomic Target laevis.S
Identities 23/23
genome
gRNA
5' CCGGAGATACACCTCCTCCATAT 3'
   |||||||||||||||||||||||
3' GGCCTCTATGTGGAGGAGGTATA 5'
     
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr5S:47663826..47663848 23/23 Sense target olig3.S
chr6S:24807264..24807286 19/23 Antisense off-target calcr.S
chr1L:142943316..142943338 20/23 Antisense unknown
chr8L:36153302..36153324 19/23 Sense unknown
tropicalis 10.0 Chr1:183374651..183374673 19/23 Antisense off-target arhgef28
Publications
First:
Most recent:
View All Papers