Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659420

gRNA Name: olig3 gRNA1
Synonyms: laevis olig3 T2
Genomic Target: olig3

PAM Sequence: TGG
Sequence: 5' CGCCTGGTGGGGGACATCTATGG 3'



Genomic Target tropicalis laevis.S
Identities 22/23 23/23
genome
gRNA
5' CCATAGATCTCCCCCACCAGGCG 3'
   |||||||| ||||||||||||||
3' GGTATCTACAGGGGGTGGTCCGC 5'
5' CCATAGATGTCCCCCACCAGGCG 3'
   |||||||||||||||||||||||
3' GGTATCTACAGGGGGTGGTCCGC 5'
    
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr5S:47664209..47664231 23/23 Sense target olig3.S
chr4L:55764140..55764162 19/23 Sense off-target ca7.L
chr1S:36235967..36235989 19/23 Antisense unknown
chr7S:55150625..55150647 19/23 Antisense unknown
tropicalis 10.0 Chr5:60771436..60771458 22/23 Sense target olig3
Publications
First:
Most recent:
View All Papers