Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659419

gRNA Name: olig2 gRNA2
Synonyms: trop olig2 T2
Genomic Target: olig2

Sequence: 5' CCGGGAGCGCAAGCGAATGCACG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 23/23 22/23 22/23
genome
gRNA
5' CGTGCATTCGCTTGCGCTCCCGG 3'
   |||||||||||||||||||||||
3' GCACGTAAGCGAACGCGAGGGCC 5'
5' CGTGCATCCGCTTGCGCTCCCGG 3'
   ||||||| |||||||||||||||
3' GCACGTAAGCGAACGCGAGGGCC 5'
5' CGTGCATCCGCTTGCGCTCCCGG 3'
   ||||||| |||||||||||||||
3' GCACGTAAGCGAACGCGAGGGCC 5'
   
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr2L:14145461..14145483 22/23 Antisense target olig2.L
chr2S:19686905..19686927 22/23 Sense target olig2.S
tropicalis 10.0 Chr2:14940113..14940135 23/23 Antisense target olig2
Publications
First:
Most recent:
View All Papers