Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659418

gRNA Name: olig2 gRNA1
Synonyms: laevis olig2 T3
Genomic Target: olig2

PAM Sequence: TGG
Sequence: 5' CCGCTGCGGCTGCCGCATGGTGG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 21/23 23/23 23/23
genome
gRNA
5' CCACCATGCGGCCGCCGCAGCCG 3'
   |||||||||||| |||||||| |
3' GGTGGTACGCCGTCGGCGTCGCC 5'
5' CCACCATGCGGCAGCCGCAGCGG 3'
   |||||||||||||||||||||||
3' GGTGGTACGCCGTCGGCGTCGCC 5'
5' CCACCATGCGGCAGCCGCAGCGG 3'
   |||||||||||||||||||||||
3' GGTGGTACGCCGTCGGCGTCGCC 5'
   
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr2L:14145263..14145285 23/23 Sense target olig2.L
chr2S:19687103..19687125 23/23 Antisense target olig2.S
chr1L:207534138..207534160 20/23 Sense off-target tcf4.L
chr1S:171304091..171304113 19/23 Sense off-target tcf4.S
Scaffold20:8041608..8041630 19/23 Antisense off-target acap1.S
Scaffold20:8041608..8041630 19/23 Antisense off-target Xelaev18001089m
chr1S:171304091..171304113 19/23 Sense off-target Xelaev18011071m
chr4S:89099375..89099397 19/23 Sense off-target LOC108715732 [provisional:brinp3]
tropicalis 10.0 Chr2:14939915..14939937 21/23 Sense target olig2
Chr1:202988583..202988605 20/23 Sense off-target tcf4
Publications
First:
Most recent:
View All Papers