Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659405

gRNA Name: mcidas gRNA2
Synonyms: laevis mcidas T2
Genomic Target: mcidas

PAM Sequence: CGG
Sequence: 5' TAAACTGATCGACTGCATCTCGG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 22/23 23/23 23/23
genome
gRNA
5' CCGAGATGCAGTGGATCAGTTTA 3' |||||||||||| |||||||||| 3' GGCTCTACGTCAGCTAGTCAAAT 5' 5' CCGAGATGCAGTCGATCAGTTTA 3' ||||||||||||||||||||||| 3' GGCTCTACGTCAGCTAGTCAAAT 5' 5' CCGAGATGCAGTCGATCAGTTTA 3' ||||||||||||||||||||||| 3' GGCTCTACGTCAGCTAGTCAAAT 5'
Genomic Alignments Position Identity Strand Genomic Target
laevis 9.2 chr1L:195646561..195646583 23/23 Antisense target mcidas.L
chr1S:160509805..160509827 23/23 Antisense target mcidas.S
chr6L:54762897..54762919 19/23 Sense off-target egfr.L
tropicalis 10.0 Chr1:191670796..191670818 22/23 Antisense mcidas
Publications
First:
Most recent:
View All Papers