Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659395

gRNA Name: kit gRNA1
Synonyms: trop kit T2
Genomic Target: kit

PAM Sequence: TGG
Sequence: 5' TGTCAAGCAGAAAACGCTATTGG 3'



Genomic Target tropicalis laevis.L
Identities 23/23 23/23
genome
gRNA
5' CCAATAGCGTTTTCTGCTTGACA 3'
   |||||||||||||||||||||||
3' GGTTATCGCAAAAGACGAACTGT 5'
5' CCAATAGCGTTTTCTGCTTGACA 3'
   |||||||||||||||||||||||
3' GGTTATCGCAAAAGACGAACTGT 5'
    
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr1L:32701295..32701317 23/23 Sense target kit.L
Scaffold143:50740..50762 21/23 Antisense off-target g67.L
chr3L:118223494..118223516 20/23 Sense off-target psd4.L
chr3S:97443964..97443986 20/23 Sense off-target n4bp3.S
chr7L:18769384..18769406 20/23 Antisense off-target dock1.L
chr3S:57688691..57688713 20/23 Antisense off-target znf609.S
chr9_10L:46034014..46034036 20/23 Antisense off-target clasp1.L
chr1L:155697632..155697654 20/23 Antisense off-target LOC108716097
chr6L:110446493..110446515 20/23 Sense off-target LOC108719227 [provisional:kctd1]
chr3L:45088147..45088169 20/23 Sense off-target LOC108710247 [provisional:ptprq]
chr2S:63069281..63069303 19/23 Antisense off-target rps6ka6.S
chr4L:81317380..81317402 20/23 Sense unknown
chr6S:92729223..92729245 20/23 Antisense unknown
chr1S:151266390..151266412 20/23 Sense unknown
chr2S:110526566..110526588 20/23 Antisense unknown
chr8L:68964244..68964266 20/23 Sense unknown
chr9_10L:11213367..11213389 20/23 Antisense unknown
chr9_10S:56262559..56262581 20/23 Sense unknown
chr4L:72585014..72585036 19/23 Antisense unknown
chr4L:83828415..83828437 19/23 Antisense unknown
chr8L:66506740..66506762 19/23 Antisense unknown
chr8S:38394842..38394864 19/23 Antisense unknown
tropicalis 10.0 Chr1:40177656..40177678 23/23 Sense target kit
Chr1:44656239..44656261 20/23 Antisense off-target LOC100487093
Chr7:124107146..124107168 20/23 Sense off-target LOC100493190
Chr4:118780664..118780686 19/23 Sense off-target atf6
Chr10:17735804..17735826 20/23 Sense unknown
Chr7:123167600..123167622 20/23 Sense unknown
Chr1:64102886..64102908 19/23 Sense unknown
Publications
First:
Most recent:
View All Papers