Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659392

gRNA Name: irx3 gRNA1
Synonyms: trop irx3 T2
Genomic Target: irx3

PAM Sequence: AGG
Sequence: 5' AAAGAACCCATATCCGACCAAGG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 23/23 22/23 22/23
genome
gRNA
5' CCTTGGTCGGATATGGGTTCTTT 3'
   |||||||||||||||||||||||
3' GGAACCAGCCTATACCCAAGAAA 5'
5' CCTTGGTCGGATAGGGGTTCTTT 3'
   ||||||||||||| |||||||||
3' GGAACCAGCCTATACCCAAGAAA 5'
5' CCTTGGTCGGATACGGGTTCTTT 3'
   ||||||||||||| |||||||||
3' GGAACCAGCCTATACCCAAGAAA 5'
   
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr4L:31935291..31935313 22/23 Antisense target irx3.L
chr4S:24047035..24047057 22/23 Antisense target irx3.S
chr6L:66217957..66217979 21/23 Sense off-target irx1.L
chr6S:53562930..53562952 21/23 Antisense off-target irx1.S
chr9_10S:1007397..1007419 20/23 Antisense unknown
chr1S:21390848..21390870 19/23 Sense unknown
tropicalis 10.0 Chr4:41853106..41853128 23/23 Antisense target irx3
Publications
First:
Most recent:
View All Papers