Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659391

gRNA Name: irx2 gRNA1
Synonyms: trop irx2 T6
Genomic Target: irx2

Sequence: 5' CCAACTTAATGATCCTGCATACA 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 23/23 22/23 22/23
genome
gRNA
5' TGTATGCAGGATCATTAAGTTGG 3'
   |||||||||||||||||||||||
3' ACATACGTCCTAGTAATTCAACC 5'
5' TGTATGCAGGGTCATTAAGTTGG 3'
   |||||||||| ||||||||||||
3' ACATACGTCCTAGTAATTCAACC 5'
5' TGTATGCAGGGTCATTAAGTTGG 3'
   |||||||||| ||||||||||||
3' ACATACGTCCTAGTAATTCAACC 5'
   
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr6L:65696284..65696306 22/23 Antisense target irx2.L
chr6S:54331361..54331383 22/23 Sense target irx2.S
chr8L:26736159..26736181 19/23 Sense off-target gria3.L
chr4S:47296503..47296525 20/23 Antisense unknown
Scaffold88412:199..221 19/23 Sense unknown
tropicalis 10.0 Chr6:67765118..67765140 23/23 Antisense target irx2
Chr6:101346409..101346431 19/23 Antisense off-target rttn
Chr9:46927561..46927583 19/23 Sense off-target rnf216
Chr1:176235897..176235919 19/23 Sense unknown
Chr9:26531050..26531072 19/23 Sense unknown
Publications
First:
Most recent:
View All Papers