Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659387

gRNA Name: insm2 gRNA1
Synonyms: trop insm2 T1
Genomic Target: insm2

Sequence: 5' CCTTACAGCCCAGTGCAGCCGAC 3'



Genomic Target tropicalis laevis.L
Identities 23/23 21/23
genome
gRNA
5' GTCGGCTGCACTGGGCTGTAAGG 3'
   |||||||||||||||||||||||
3' CAGCCGACGTGACCCGACATTCC 5'
5' GTCGGTTGCACTGGGCTGTGAGG 3'
   ||||| ||||||||||||| |||
3' CAGCCGACGTGACCCGACATTCC 5'
    
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr8L:85555128..85555150 21/23 Sense target insm2.L
chr1L:190770929..190770951 19/23 Antisense off-target LOC108718076 [provisional:mast4]
tropicalis 10.0 Chr8:108145570..108145592 23/23 Sense insm2
Chr3:120482504..120482526 19/23 Antisense unc5d
Chr4:135501855..135501877 19/23 Sense
Chr7:71750098..71750120 19/23 Antisense
Publications
First:
Most recent:
View All Papers