Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659386

gRNA Name: il2rg gRNA1
Synonyms: laevis il2rg T1
Genomic Target: il2rg

Sequence: 5' CCTTCGCTGATCTTCATCACCCT 3'



Genomic Target laevis.L
Identities 23/23
genome
gRNA
5' AGGGTGATGAAGATCAGCGAAGG 3'
   |||||||||||||||||||||||
3' TCCCACTACTTCTAGTCGCTTCC 5'
     
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr8L:22146430..22146452 23/23 Antisense target il2rg.L
tropicalis 10.0 Chr1:175213696..175213718 19/23 Sense
Publications
First:
Most recent:
View All Papers