Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659384

gRNA Name: hpse2 gRNA1
Synonyms: trop hpse2 T2
Genomic Target: hpse2

Sequence: 5' CCCTAAGAAAAATGTCATAGCCC 3'



Genomic Target tropicalis laevis.L
Identities 23/23 23/23
genome
gRNA
5' GGGCTATGACATTTTTCTTAGGG 3'
   |||||||||||||||||||||||
3' CCCGATACTGTAAAAAGAATCCC 5'
5' GGGCTATGACATTTTTCTTAGGG 3'
   |||||||||||||||||||||||
3' CCCGATACTGTAAAAAGAATCCC 5'
    
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr7L:29573740..29573762 23/23 Antisense target hpse2.L
chr2S:56242915..56242937 19/23 Sense off-target tfeb.S
chr9_10L:97118646..97118668 19/23 Antisense off-target baiap3.L
chr6L:72583497..72583519 19/23 Sense off-target LOC108718513 [provisional:dnah5]
chr9_10L:23020033..23020055 19/23 Antisense off-target LOC108700990 [provisional:endov]
chr7S:45890850..45890872 19/23 Sense off-target LOC108697229 [provisional:kirrel3]
Scaffold27:27609..27631 20/23 Antisense unknown
chr1S:111788592..111788614 19/23 Antisense unknown
chr1S:34901602..34901624 19/23 Sense unknown
chr1S:61507915..61507937 19/23 Sense unknown
chr2L:117812910..117812932 19/23 Antisense unknown
chr2L:36925351..36925373 19/23 Antisense unknown
chr2S:155017629..155017651 19/23 Antisense unknown
chr3S:114693244..114693266 19/23 Antisense unknown
chr3S:119667947..119667969 19/23 Sense unknown
chr3S:17160397..17160419 19/23 Antisense unknown
chr5L:28863005..28863027 19/23 Sense unknown
chr5L:71246847..71246869 19/23 Sense unknown
chr6L:80553018..80553040 19/23 Antisense unknown
chr6S:116817571..116817593 19/23 Antisense unknown
chr7L:47345350..47345372 19/23 Antisense unknown
chr8S:71487279..71487301 19/23 Sense unknown
tropicalis 10.0 Chr7:35042584..35042606 23/23 Antisense target hpse2
Chr4:11760381..11760403 21/23 Antisense off-target LOC116410243
Chr4:11760381..11760403 21/23 Antisense off-target LOC101731664
Chr1:60284038..60284060 19/23 Sense off-target znf330
Chr3:136002350..136002372 19/23 Antisense off-target clec4e
Chr5:42463584..42463606 19/23 Sense off-target tmem178a
Chr9:55826295..55826317 20/23 Sense unknown
Chr10:33345269..33345291 19/23 Sense unknown
Chr3:45763409..45763431 19/23 Sense unknown
Publications
First:
Most recent:
View All Papers