Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659383

gRNA Name: hmgcr gRNA2
Synonyms: laevis hmgcr T5
Genomic Target: hmgcr

PAM Sequence: AGG
Sequence: 5' GCCCGTGGCATGGCAATTCTAGG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 22/23 23/23 23/23
genome
gRNA
5' CCTAAAATTGCCATGCCACGGGC 3'
   |||| ||||||||||||||||||
3' GGATCTTAACGGTACGGTGCCCG 5'
5' CCTAGAATTGCCATGCCACGGGC 3'
   |||||||||||||||||||||||
3' GGATCTTAACGGTACGGTGCCCG 5'
5' CCTAGAATTGCCATGCCACGGGC 3'
   |||||||||||||||||||||||
3' GGATCTTAACGGTACGGTGCCCG 5'
   
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr1L:187447098..187447120 23/23 Sense target hmgcr.L
chr1S:156431941..156431963 23/23 Sense target hmgcr.S
chr2S:82364280..82364302 19/23 Sense unknown
chr5L:104543355..104543377 19/23 Antisense unknown
tropicalis 10.0 Chr1:184201686..184201708 22/23 Sense target hmgcr
Chr8:60585571..60585593 20/23 Antisense off-target pcdh11x
Chr3:103996280..103996302 21/23 Sense unknown
Publications
First:
Most recent:
View All Papers