Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659366

gRNA Name: ezh2 gRNA3
Synonyms: trop ezh2 T2
Genomic Target: ezh2

PAM Sequence: TGG
Sequence: 5' CATTAACGATGAGATATTTGTGG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 23/23 22/23 22/23
genome
gRNA
5' CCACAAATATCTCATCGTTAATG 3'
   |||||||||||||||||||||||
3' GGTGTTTATAGAGTAGCAATTAC 5'
5' CCACAAATATCTCATCATTAATG 3'
   |||||||||||||||| ||||||
3' GGTGTTTATAGAGTAGCAATTAC 5'
5' CCACAAATATCTCATCATTAATG 3'
   |||||||||||||||| ||||||
3' GGTGTTTATAGAGTAGCAATTAC 5'
   
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr6L:58337254..58337276 22/23 Sense target ezh2.L
Chr6S:48267504..48267526 22/23 Sense target ezh2.S
Chr6L:36942395..36942417 20/23 Sense off-target agmo.L
Chr8S:101955667..101955689 20/23 Sense off-target sema4a.S
Chr4L:4062294..4062316 20/23 Antisense off-target galnt18.L
Chr6L:36942395..36942417 20/23 Sense off-target LOC121394543
Chr3S:126639873..126639895 19/23 Sense unknown
tropicalis 10.0 Chr6:55154761..55154783 23/23 Sense target ezh2
Chr3:108129660..108129682 20/23 Antisense off-target rccd1
Chr1:172320689..172320711 19/23 Antisense unknown
Chr4:79288561..79288583 19/23 Sense unknown
Publications
First:
Most recent:
View All Papers