Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659365

gRNA Name: eya1 gRNA5
Synonyms: trop eya1 T1
Genomic Target: eya1

PAM Sequence: AGG
Sequence: 5' TGGGCAGGCATCAAGACGGAAGG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 23/23 23/23 23/23
genome
gRNA
5' CCTTCCGTCTTGATGCCTGCCCA 3'
   |||||||||||||||||||||||
3' GGAAGGCAGAACTACGGACGGGT 5'
5' CCTTCCGTCTTGATGCCTGCCCA 3'
   |||||||||||||||||||||||
3' GGAAGGCAGAACTACGGACGGGT 5'
5' CCTTCCGTCTTGATGCCTGCCCA 3'
   |||||||||||||||||||||||
3' GGAAGGCAGAACTACGGACGGGT 5'
   
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr6L:129133761..129133783 23/23 Antisense target eya1.L
Chr6S:106173652..106173674 23/23 Antisense target eya1.S
Chr7S:16290322..16290344 19/23 Antisense off-target znf518a.S
tropicalis 10.0 Chr6:120532783..120532805 23/23 Antisense target eya1
Chr5:7657640..7657662 19/23 Sense off-target cdc42bpa
Publications
First:
Most recent:
View All Papers