Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659363

gRNA Name: eya1 gRNA2
Synonyms: laevis eya1 T2
Genomic Target: eya1

PAM Sequence: CGG
Sequence: 5' TGGACAGACACAATTCTCCTCGG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 23/23 23/23 23/23
genome
gRNA
5' CCGAGGAGAATTGTGTCTGTCCA 3'
   |||||||||||||||||||||||
3' GGCTCCTCTTAACACAGACAGGT 5'
5' CCGAGGAGAATTGTGTCTGTCCA 3'
   |||||||||||||||||||||||
3' GGCTCCTCTTAACACAGACAGGT 5'
5' CCGAGGAGAATTGTGTCTGTCCA 3'
   |||||||||||||||||||||||
3' GGCTCCTCTTAACACAGACAGGT 5'
   
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr6L:129135330..129135352 23/23 Antisense target eya1.L
Chr6S:106175187..106175209 23/23 Antisense target eya1.S
Chr4L:2457978..2458000 19/23 Sense off-target scube2.L
Chr3S:12372346..12372368 19/23 Sense off-target LOC108712610
Chr4L:117146451..117146473 20/23 Sense unknown
Chr1S:197013506..197013528 19/23 Antisense unknown
Chr1S:29279465..29279487 19/23 Sense unknown
Chr9_10S:68603208..68603230 19/23 Antisense unknown
tropicalis 10.0 Chr6:120533949..120533971 23/23 Antisense target eya1
Chr5:97925594..97925616 20/23 Antisense off-target csmd1
Chr1:188017062..188017084 19/23 Sense off-target adamts6
Publications
First:
Most recent:
View All Papers