Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659362

gRNA Name: eya1 gRNA4
Synonyms: laevis eya1 T1
Genomic Target: eya1

PAM Sequence: AGG
Sequence: 5' GGACATTTAGACAACTTCTCAGG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 23/23 23/23 23/23
genome
gRNA
5' CCTGAGAAGTTGTCTAAATGTCC 3'
   |||||||||||||||||||||||
3' GGACTCTTCAACAGATTTACAGG 5'
5' CCTGAGAAGTTGTCTAAATGTCC 3'
   |||||||||||||||||||||||
3' GGACTCTTCAACAGATTTACAGG 5'
5' CCTGAGAAGTTGTCTAAATGTCC 3'
   |||||||||||||||||||||||
3' GGACTCTTCAACAGATTTACAGG 5'
   
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr6L:129136996..129137018 23/23 Antisense target eya1.L
Chr6S:106178510..106178532 23/23 Antisense target eya1.S
Chr2S:113760209..113760231 19/23 Antisense off-target gpc6.S
Chr8L:249231..249253 20/23 Sense unknown
Chr6S:94976188..94976210 19/23 Sense unknown
Chr7S:44337707..44337729 19/23 Sense unknown
Chr8L:60446614..60446636 19/23 Sense unknown
tropicalis 10.0 Chr6:120536279..120536301 23/23 Antisense target eya1
Chr8:72619160..72619182 19/23 Antisense unknown
Publications
First:
Most recent:
View All Papers