Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659361

gRNA Name: erf gRNA2
Synonyms: trop erf T2
Genomic Target: erf

PAM Sequence: CGG
Sequence: 5' TGGCACGTCTGTGGGGTGTTCGG 3'



Genomic Target tropicalis laevis.S
Identities 23/23 21/23
genome
gRNA
5' CCGAACACCCCACAGACGTGCCA 3'
   |||||||||||||||||||||||
3' GGCTTGTGGGGTGTCTGCACGGT 5'
5' CCGAACGCCCCACAGACGCGCCA 3'
   |||||| ||||||||||| ||||
3' GGCTTGTGGGGTGTCTGCACGGT 5'
    
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr7S:94383146..94383168 21/23 Antisense target erf.S
Chr9_10L:84061303..84061325 19/23 Antisense unknown
tropicalis 10.0 Chr7:107365670..107365692 23/23 Antisense target erf
Chr7:106797603..106797625 20/23 Antisense off-target erfl
Chr4:36220983..36221005 20/23 Antisense off-target mark2
Publications
First:
Most recent:
View All Papers