Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659360

gRNA Name: erf gRNA1
Synonyms: trop erf T1
Genomic Target: erf

Sequence: 5' CCATGAAAACCCCGGCAGAGCCA 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 23/23 23/23 23/23
genome
gRNA
5' TGGCTCTGCCGGGGTTTTCATGG 3'
   |||||||||||||||||||||||
3' ACCGAGACGGCCCCAAAAGTACC 5'
5' TGGCTCTGCCGGGGTTTTCATGG 3'
   |||||||||||||||||||||||
3' ACCGAGACGGCCCCAAAAGTACC 5'
5' TGGCTCTGCCGGGGTTTTCATGG 3'
   |||||||||||||||||||||||
3' ACCGAGACGGCCCCAAAAGTACC 5'
   
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr7L:112693584..112693606 23/23 Antisense target erf.L
Chr7S:94424286..94424308 23/23 Antisense target erf.S
Chr3S:86666009..86666031 19/23 Sense unknown
tropicalis 10.0 Chr7:107392814..107392836 23/23 Antisense target erf
Publications
First:
Most recent:
View All Papers