Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659359

gRNA Name: eomes gRNA2
Synonyms: trop eomes T4
Genomic Target: eomes

PAM Sequence: TGG
Sequence: 5' GGTTCCACCAGCACTGCCTCTGG 3'



Genomic Target tropicalis
Identities 23/23
genome
gRNA
5' CCAGAGGCAGTGCTGGTGGAACC 3'
   |||||||||||||||||||||||
3' GGTCTCCGTCACGACCACCTTGG 5'
     
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr6L:90268839..90268861 19/23 Antisense off-target bcl2.L
Chr5L:157554764..157554786 19/23 Sense off-target eva1a.L
Chr6L:127363083..127363105 19/23 Sense off-target cops5.L
Chr9_10L:46776626..46776648 19/23 Antisense off-target cdr2l.L
Chr9_10S:39252148..39252170 19/23 Antisense off-target cdr2l.S
Chr1L:181215042..181215064 20/23 Antisense unknown
Chr9_10S:97880874..97880896 20/23 Sense unknown
Chr8L:10529173..10529195 19/23 Antisense unknown
Chr9_10L:78323387..78323409 19/23 Sense unknown
tropicalis 10.0 Chr6:48273488..48273510 23/23 Antisense target eomes
Chr3:6864531..6864553 19/23 Sense off-target agbl3
Chr8:62771219..62771241 19/23 Antisense off-target dach2
Chr7:20919963..20919985 19/23 Sense off-target pwwp2b
Chr2:83751593..83751615 19/23 Antisense off-target inpp5b
Chr9:66749658..66749680 19/23 Sense off-target LOC100497531
Chr3:146693394..146693416 19/23 Sense unknown
Chr3:146702284..146702306 19/23 Sense unknown
Chr8:147068104..147068126 19/23 Sense unknown
Publications
First:
Most recent:
View All Papers