Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659358

gRNA Name: eomes gRNA1
Synonyms: trop eomes T2
Genomic Target: eomes

Sequence: 5' CCGCGCAAGCTCTTGGTGGAATT 3'



Genomic Target tropicalis
Identities 23/23
genome
gRNA
5' AATTCCACCAAGAGCTTGCGCGG 3'
   |||||||||||||||||||||||
3' TTAAGGTGGTTCTCGAACGCGCC 5'
     
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr1S:82108730..82108752 19/23 Sense unknown
tropicalis 10.0 Chr6:48271167..48271189 23/23 Antisense target eomes
Publications
First:
Most recent:
View All Papers