Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659357

gRNA Name: dzip1 gRNA1
Synonyms: dzip1.L
Genomic Target: dzip1

PAM Sequence: TGG
Sequence: 5' AAGACAAGGAGAACTCAGGATGG 3'



Genomic Target laevis.L
Identities 23/23
genome
gRNA
5' CCATCCTGAGTTCTCCTTGTCTT 3'
   |||||||||||||||||||||||
3' GGTAGGACTCAAGAGGAACAGAA 5'
     
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr2L:127402948..127402970 23/23 Antisense target dzip1.L
Chr7S:324341..324363 20/23 Sense off-target sorcs1.S
Chr1L:10444296..10444318 19/23 Sense off-target adam33.L
Chr5L:63900575..63900597 19/23 Sense off-target abracl.L
Chr4S:4441374..4441396 19/23 Antisense off-target LOC121393158
Chr5S:122460037..122460059 19/23 Sense unknown
tropicalis 10.0 Chr2:110601565..110601587 19/23 Sense off-target map4k4
Chr7:64528121..64528143 19/23 Sense off-target LOC101731286
Publications
First:
Most recent:
View All Papers