Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659356

gRNA Name: dysf gRNA1
Synonyms: dysferlin, trop dysf T3
Genomic Target: dysf

PAM Sequence: AGG
Sequence: 5' CTTCTCCAAGACCAGAGAAGAGG 3'



Genomic Target tropicalis
Identities 23/23
genome
gRNA
5' CCTCTTCTCTGGTCTTGGAGAAG 3'
   |||||||||||||||||||||||
3' GGAGAAGAGACCAGAACCTCTTC 5'
     
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr7L:8376103..8376125 21/23 Sense off-target LOC108696071
Chr4L:107421941..107421963 20/23 Antisense off-target vav3.L
Chr4S:90095742..90095764 20/23 Antisense off-target vav3.S
Chr7S:5967684..5967706 20/23 Sense off-target prkg1.S
Chr2L:56775300..56775322 20/23 Antisense off-target col8a2.L
Chr8L:102964947..102964969 20/23 Antisense off-target arhgap11a.1.L
Chr9_10L:130244491..130244513 19/23 Sense off-target LOC100037197
Chr6L:153959155..153959177 19/23 Antisense unknown
Chr6S:130468836..130468858 19/23 Antisense unknown
tropicalis 10.0 Chr7:38721213..38721235 23/23 Sense target dysf
Chr4:110709029..110709051 20/23 Antisense off-target vav3
Publications
First:
Most recent:
View All Papers