Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659354

gRNA Name: dmrt1 gRNA3
Synonyms: dmrt1.S
Genomic Target: dmrt1

PAM Sequence: CGG
Sequence: 5' ATGGGTGCTGCCCGGTGCTACGG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 20/23 21/23 23/23
genome
gRNA
5' TCGTAGCTCTGGGCAGCACCCAT 3'
    |||||| | |||||||||||||
3' GGCATCGTGGCCCGTCGTGGGTA 5'
5' CCGTAACTCCGGGCAGCACCCAT 3'
   ||||| | |||||||||||||||
3' GGCATCGTGGCCCGTCGTGGGTA 5'
5' CCGTAGCACCGGGCAGCACCCAT 3'
   |||||||||||||||||||||||
3' GGCATCGTGGCCCGTCGTGGGTA 5'
   
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr1S:118842680..118842702 23/23 Sense target dmrt1.S
Chr1L:139345607..139345629 21/23 Sense target dmrt1.L
tropicalis 10.0 Chr1:128745024..128745046 20/23 Sense target dmrt1
Chr1:120800611..120800633 21/23 Antisense off-target klf4
Chr5:3914960..3914982 19/23 Antisense off-target kif6
Chr4:10800280..10800302 19/23 Sense off-target ldlrad3
Chr7:6425266..6425288 19/23 Antisense off-target LOC100497344
Publications
First:
Most recent:
View All Papers