Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659353

gRNA Name: dmrt1 gRNA2
Synonyms: dmrt1.L
Genomic Target: dmrt1

PAM Sequence: CGG
Sequence: 5' CCCGTAACTCCGGGCAGCACCGG 3'



Genomic Target laevis.L laevis.S
Identities 21/23 19/23
genome
gRNA
5' TGGGTGCTGCCCGGAGTTACGGG 3'
     |||||||||||||||||||||
3' GGCCACGACGGGCCTCAATGCCC 5'
5' TGGGTGCTGCCCGGTGCTACGGG 3'
     |||||||||||| | ||||||
3' GGCCACGACGGGCCTCAATGCCC 5'
    
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr1L:139345608..139345630 21/23 Antisense target dmrt1.L
Chr1S:118842681..118842703 19/23 Antisense target dmrt1.S
tropicalis 10.0 Chr3:152285098..152285120 19/23 Antisense off-target tfr2
Chr1:59608796..59608818 20/23 Sense unknown
Publications
First:
Most recent:
View All Papers