Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659351

gRNA Name: dtl gRNA1
Synonyms: trop dtl T1
Genomic Target: dtl

PAM Sequence: GGG
Sequence: 5' TGTTTAGGTTACAGCTTCAGGGG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 23/23 20/23 21/23
genome
gRNA
5' CCCCTGAAGCTGTAACCTAAACA 3'
   |||||||||||||||||||||||
3' GGGGACTTCGACATTGGATTTGT 5'
5' CCCCTGAAGCTGTAACCTACAAG 3'
   ||||||||||||||||||| |  
3' GGGGACTTCGACATTGGATTTGT 5'
5' CCCCTGAAGCTGTAACCTAAAAT 3'
   |||||||||||||||||||||  
3' GGGGACTTCGACATTGGATTTGT 5'
   
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr5S:17462395..17462417 21/23 Antisense target dtl.S
Chr5L:11527273..11527295 20/23 Sense target dtl.L
Chr3S:112992124..112992146 20/23 Sense off-target LOC108712409
Chr7L:85940128..85940150 19/23 Sense off-target sik2.L
Chr7S:106011048..106011070 19/23 Sense off-target ppp2r1a.S
Chr9_10L:113626634..113626656 19/23 Antisense off-target LOC121398039
Chr2L:136690545..136690567 19/23 Antisense unknown
Chr2L:79361707..79361729 19/23 Antisense unknown
Chr6S:59016464..59016486 19/23 Sense unknown
tropicalis 10.0 Chr5:14745354..14745376 23/23 Antisense target dtl
Chr7:68331564..68331586 19/23 Antisense off-target opcml
Chr6:127594906..127594928 20/23 Antisense unknown
Chr7:23210802..23210824 20/23 Antisense unknown
Chr2:130518746..130518768 19/23 Antisense unknown
Chr6:64263160..64263182 19/23 Antisense unknown
Publications
First:
Most recent:
View All Papers