Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659329

gRNA Name: csnk1g2 gRNA1
Synonyms:
Genomic Target: csnk1g2

PAM Sequence: AGG
Sequence: 5' GCTGTTGGGACCTAGTCTAGAGG 3'



Genomic Target tropicalis laevis.L
Identities 23/23 20/23
genome
gRNA
5' CCTCTAGACTAGGTCCCAACAGC 3'
   |||||||||||||||||||||||
3' GGAGATCTGATCCAGGGTTGTCG 5'
5' CCTCTAGACTAGGCCCCAATAAC 3'
   ||||||||||||| ||||| | |
3' GGAGATCTGATCCAGGGTTGTCG 5'
    
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr1L:112322975..112322997 20/23 Antisense target csnk1g2.L
Chr1S:188580668..188580690 19/23 Sense unknown
tropicalis 10.0 Chr1:102998726..102998748 23/23 Antisense target csnk1g2
Publications
First:
Most recent:
View All Papers