Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659328

gRNA Name: csf3r gRNA1
Synonyms:
Genomic Target: csf3r

PAM Sequence: TGG
Sequence: 5' GAAAGGCAGACGAGAACCAATGG 3'



Genomic Target laevis.L
Identities 23/23
genome
gRNA
5' CCATTGGTTCTCGTCTGCCTTTC 3'
   |||||||||||||||||||||||
3' GGTAACCAAGAGCAGACGGAAAG 5'
     
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr2L:57186407..57186429 23/23 Sense target csf3r.L
Chr2S:71855664..71855686 22/23 Antisense off-target LOC108704665
Chr2S:72217262..72217284 22/23 Antisense off-target LOC121400591
Chr2S:72024103..72024125 22/23 Antisense unknown
Chr1S:82489259..82489281 19/23 Antisense unknown
Chr2S:49542308..49542330 19/23 Antisense unknown
tropicalis 10.0 Chr7:39562178..39562200 21/23 Antisense off-target anxa7
Chr2:74632692..74632714 19/23 Sense off-target tmem167b
Publications
First:
Most recent:
View All Papers