Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659327

gRNA Name: chd2 gRNA1
Synonyms:
Genomic Target: chd2

PAM Sequence: GGG
Sequence: 5' GGGAAGATGGTGCCCTTGTTGGG 3'



Genomic Target tropicalis laevis.L
Identities 23/23 23/23
genome
gRNA
5' CCCAACAAGGGCACCATCTTCCC 3'
   |||||||||||||||||||||||
3' GGGTTGTTCCCGTGGTAGAAGGG 5'
5' CCCAACAAGGGCACCATCTTCCC 3'
   |||||||||||||||||||||||
3' GGGTTGTTCCCGTGGTAGAAGGG 5'
    
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr3L:118608105..118608127 23/23 Sense target chd2.L
Chr6L:3819270..3819292 19/23 Antisense off-target znf214
Chr1L:211100574..211100596 19/23 Antisense off-target parp8.L
Chr6L:3819270..3819292 19/23 Antisense off-target znf84.L
Chr2S:56210410..56210432 19/23 Antisense off-target dennd2d.S
Chr5L:8263346..8263368 19/23 Sense off-target LOC108716087
Chr7S:86699888..86699910 19/23 Antisense off-target LOC121396514
Chr1S:136890048..136890070 20/23 Sense unknown
Chr2S:9493549..9493571 20/23 Sense unknown
Chr1L:231383487..231383509 19/23 Sense unknown
Chr2L:16392920..16392942 19/23 Antisense unknown
Chr3S:82969414..82969436 19/23 Antisense unknown
Chr8L:97126225..97126247 19/23 Sense unknown
tropicalis 10.0 Chr3:112485335..112485357 23/23 Sense target chd2
Chr8:33865956..33865978 20/23 Sense off-target astn2
Chr1:56701852..56701874 19/23 Sense off-target lrba
Chr4:140789818..140789840 19/23 Sense off-target foxp1
Chr4:84082243..84082265 19/23 Sense off-target pde4b
Chr9:57262392..57262414 19/23 Sense off-target erbb4
Chr7:35366093..35366115 19/23 Antisense off-target slc25a28
Chr4:106697883..106697905 19/23 Antisense unknown
Chr4:121087284..121087306 19/23 Sense unknown
Chr4:2927903..2927925 19/23 Sense unknown
Chr8:110640892..110640914 19/23 Sense unknown
Publications
First:
Most recent:
View All Papers