Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659326

gRNA Name: celsr3 gRNA1
Synonyms:
Genomic Target: celsr3

Sequence: 5' CCCTATATTGCAGTTGAGAGCCA 3'



Genomic Target tropicalis
Identities 23/23
genome
gRNA
5' TGGCTCTCAACTGCAATATAGGG 3'
   |||||||||||||||||||||||
3' ACCGAGAGTTGACGTTATATCCC 5'
     
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr4L:136398469..136398491 23/23 Antisense off-target LOC108714671
Chr9_10L:85650613..85650635 19/23 Antisense off-target erbb4.L
Chr2L:53377612..53377634 19/23 Antisense unknown
Chr2S:78546943..78546965 19/23 Antisense unknown
Chr6L:77486950..77486972 19/23 Sense unknown
tropicalis 10.0 Chr4:136096619..136096641 23/23 Antisense target celsr3
Chr9:53038364..53038386 19/23 Sense off-target LOC100127872
Publications
First:
Most recent:
View All Papers