Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659325

gRNA Name: celf3 gRNA1
Synonyms:
Genomic Target: celf3

Sequence: 5' CTCAAGCCTAGTAGTGAAGTTTG 3'



Genomic Target tropicalis
Identities 23/23
genome
gRNA
5' CAAACTTCACTACTAGGCTTGAG 3'
   |||||||||||||||||||||||
3' GTTTGAAGTGATGATCCGAACTC 5'
     
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr1S:37849042..37849064 20/23 Antisense off-target galnt7.S
Chr5S:131789204..131789226 19/23 Antisense unknown
tropicalis 10.0 Chr8:144679285..144679307 23/23 Sense target celf3
Chr3:81515026..81515048 19/23 Antisense off-target frmd4a
Chr9:55214794..55214816 19/23 Sense off-target fam207a
Chr6:108538652..108538674 19/23 Antisense unknown
Publications
First:
Most recent:
View All Papers