Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659324

gRNA Name: ccdc78 gRNA1
Synonyms:
Genomic Target: ccdc78

PAM Sequence: TGG
Sequence: 5' GGGCGAGTTACAGGACAAGATGG 3'



Genomic Target tropicalis laevis.S
Identities 21/23 23/23
genome
gRNA
5' CCATCTTATCCTGTAACTCACCC 3'
   ||||||| ||||||||||| |||
3' GGTAGAACAGGACATTGAGCGGG 5'
5' CCATCTTGTCCTGTAACTCGCCC 3'
   |||||||||||||||||||||||
3' GGTAGAACAGGACATTGAGCGGG 5'
    
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr9_10S:117204749..117204771 23/23 Sense target ccdc78.S
Chr9_10S:2556697..2556719 20/23 Antisense unknown
tropicalis 10.0 Chr9:190457..190479 21/23 Antisense target ccdc78
Chr4:853900..853922 20/23 Sense unknown
Chr6:25765252..25765274 19/23 Sense unknown
Publications
First:
Most recent:
View All Papers