Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659323

gRNA Name: cacna1h gRNA1
Synonyms:
Genomic Target: cacna1h

PAM Sequence: AGG
Sequence: 5' GTTACAATTTCACCCCTCTGAGG 3'



Genomic Target tropicalis laevis.L
Identities 23/23 21/23
genome
gRNA
5' CCTCAGAGGGGTGAAATTGTAAC 3'
   |||||||||||||||||||||||
3' GGAGTCTCCCCACTTTAACATTG 5'
5' CCTCAGAGAGGAGAAATTGTAAC 3'
   |||||||| || |||||||||||
3' GGAGTCTCCCCACTTTAACATTG 5'
    
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr9_10L:119551670..119551692 21/23 Antisense target cacna1h.L
Chr2L:140832753..140832775 20/23 Antisense off-target rubcnl.L
Chr7S:101141095..101141117 19/23 Antisense off-target grin2d.S
Chr4L:71318756..71318778 19/23 Antisense off-target col24a1.L
Chr7L:64405339..64405361 19/23 Antisense off-target XB996286.L
Chr7S:88433902..88433924 19/23 Antisense off-target LOC108697250
Chr4L:42723255..42723277 20/23 Antisense unknown
Chr1S:84821810..84821832 19/23 Sense unknown
Chr6L:91440366..91440388 19/23 Antisense unknown
Chr1L:32525800..32525822 19/23 Sense unknown
Chr8L:28131900..28131922 19/23 Sense unknown
tropicalis 10.0 Chr9:18199211..18199233 23/23 Sense target cacna1h
Chr4:70886349..70886371 19/23 Sense off-target znf536
Chr3:40945977..40945999 19/23 Sense unknown
Chr4:124944184..124944206 19/23 Antisense unknown
Chr4:124956606..124956628 19/23 Antisense unknown
Publications
First:
Most recent:
View All Papers