Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659322

gRNA Name: bicc1 gRNA1
Synonyms:
Genomic Target: bicc1

PAM Sequence: AGG
Sequence: 5' GGTTGCAGGATCCCGGCTATAGG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 23/23 22/23 22/23
genome
gRNA
5' CCTATAGCCGGGATCCTGCAACC 3'
   |||||||||||||||||||||||
3' GGATATCGGCCCTAGGACGTTGG 5'
5' CCTATAGCCGGGATTCTGCAACC 3'
   |||||||||||||| ||||||||
3' GGATATCGGCCCTAGGACGTTGG 5'
5' CCTATAGCCGGGATTCTGCAACC 3'
   |||||||||||||| ||||||||
3' GGATATCGGCCCTAGGACGTTGG 5'
   
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr7L:10540259..10540281 22/23 Antisense target bicc1.L
Chr7S:7770223..7770245 22/23 Antisense target bicc1.S
Chr5S:66237861..66237883 19/23 Antisense unknown
tropicalis 10.0 Chr7:15935708..15935730 23/23 Antisense target bicc1
Chr7:1442246..1442268 20/23 Antisense off-target sorcs1
Publications
First:
Most recent:
View All Papers