Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659321

gRNA Name: bhlhe22 gRNA1
Synonyms:
Genomic Target: bhlhe22

PAM Sequence: CGG
Sequence: 5' CGTGCATTCGCCTCCTCTCCCGG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 23/23 23/23 23/23
genome
gRNA
5' CCGGGAGAGGAGGCGAATGCACG 3'
   |||||||||||||||||||||||
3' GGCCCTCTCCTCCGCTTACGTGC 5'
5' CCGGGAGAGGAGGCGAATGCACG 3'
   |||||||||||||||||||||||
3' GGCCCTCTCCTCCGCTTACGTGC 5'
5' CCGGGAGAGGAGGCGAATGCACG 3'
   |||||||||||||||||||||||
3' GGCCCTCTCCTCCGCTTACGTGC 5'
   
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr6L:126289077..126289099 23/23 Antisense target bhlhe22.L
Chr6S:103886714..103886736 23/23 Antisense target bhlhe22.S
Chr3L:10277450..10277472 23/23 Sense off-target LOC121393056
Chr3L:10277450..10277472 23/23 Sense off-target LOC121400993
Chr3L:10488762..10488784 23/23 Antisense off-target LOC121393056
Chr3L:10581553..10581575 23/23 Sense off-target LOC121393056
Chr3L:10581553..10581575 23/23 Sense off-target LOC121401053
Chr3L:10581553..10581575 23/23 Sense off-target LOC121400999
Chr3L:10626487..10626509 23/23 Sense off-target LOC121393056
Chr3L:10658535..10658557 23/23 Antisense off-target LOC121393056
Chr3L:12594830..12594852 23/23 Sense off-target LOC121400994
Chr3L:12594830..12594852 23/23 Sense off-target LOC121401009
Chr3L:13082899..13082921 23/23 Sense off-target LOC121400994
Chr3L:13082899..13082921 23/23 Sense off-target LOC121400998
Chr3L:9784195..9784217 22/23 Antisense off-target LOC121393056
Chr3L:9784195..9784217 22/23 Antisense off-target LOC121400993
Chr3L:10499108..10499130 21/23 Sense off-target LOC121393056
Chr3L:12663016..12663038 21/23 Antisense off-target LOC121400994
Chr1L:81858463..81858485 20/23 Sense off-target atoh1.L
Chr1S:65862037..65862059 20/23 Sense off-target atoh1.S
Chr3L:93355149..93355171 19/23 Antisense off-target tnpo3.L
Chr1L:122733014..122733036 19/23 Sense unknown
Chr4S:74735066..74735088 19/23 Antisense unknown
tropicalis 10.0 Chr6:118213537..118213559 23/23 Antisense target bhlhe22
Chr1:211286206..211286228 20/23 Antisense off-target kif24
Chr1:76932904..76932926 20/23 Sense off-target atoh1
Publications
First:
Most recent:
View All Papers