Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659320

gRNA Name: bcor gRNA1
Synonyms:
Genomic Target: bcor

Sequence: 5' CCCTCGGTTGGGATCCAAACAGC 3'



Genomic Target tropicalis
Identities 9/24
genome
gRNA
5' GCTGTTTGGATCCCAACCGAGGG 3'
       || |   || | |   || 
3' GACAAACCTAGGGTTGGCTCCC  5'
     
Genomic Alignments Position Identity Strand Target Genomic Target
tropicalis 10.0 Chr2:57400204..57400226 23/23 Sense target bcor
Publications
First:
Most recent:
View All Papers