Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659319

gRNA Name: bace1 gRNA2
Synonyms:
Genomic Target: bace1

Sequence: 5' CCAAAGAGAGTGTTCGATGCAGC 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 23/23 23/23 23/23
genome
gRNA
5' GCTGCATCGAACACTCTCTTTGG 3'
   |||||||||||||||||||||||
3' CGACGTAGCTTGTGAGAGAAACC 5'
5' GCTGCATCGAACACTCTCTTTGG 3'
   |||||||||||||||||||||||
3' CGACGTAGCTTGTGAGAGAAACC 5'
5' GCTGCATCGAACACTCTCTTTGG 3'
   |||||||||||||||||||||||
3' CGACGTAGCTTGTGAGAGAAACC 5'
   
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr7L:83522775..83522797 23/23 Sense target bace1.L
Chr7S:71401152..71401174 23/23 Sense target bace1.S
Chr8S:86246239..86246261 20/23 Antisense unknown
tropicalis 10.0 Chr7:81947398..81947420 23/23 Sense target bace1
Chr1:115657361..115657383 19/23 Sense unknown
Publications
First:
Most recent:
View All Papers