Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659318

gRNA Name: bace1 gRNA1
Synonyms:
Genomic Target: bace1

PAM Sequence: TGG
Sequence: 5' AGGTGAGCTAGGCACAGATTTGG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 23/23 23/23 22/23
genome
gRNA
5' CCAAATCTGTGCCTAGCTCACCT 3'
   |||||||||||||||||||||||
3' GGTTTAGACACGGATCGAGTGGA 5'
5' CCAAATCTGTGCCTAGCTCACCT 3'
   |||||||||||||||||||||||
3' GGTTTAGACACGGATCGAGTGGA 5'
5' CCAGATCTGTGCCTAGCTCACCT 3'
   ||| |||||||||||||||||||
3' GGTTTAGACACGGATCGAGTGGA 5'
   
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr7L:83516452..83516474 23/23 Sense target bace1.L
Chr7S:71394107..71394129 22/23 Sense target bace1.S
Chr2S:42305067..42305089 20/23 Antisense off-target lamb3.S
Chr9_10L:80663768..80663790 19/23 Sense off-target itga4.L
tropicalis 10.0 Chr7:81941116..81941138 23/23 Sense target bace1
Chr4:30747730..30747752 19/23 Antisense off-target chid1
Chr5:28925737..28925759 19/23 Sense off-target macrod2
Chr6:86707193..86707215 19/23 Antisense unknown
Chr8:88357631..88357653 19/23 Sense unknown
Publications
First:
Most recent:
View All Papers