Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-23659300

Morpholino Name: rab7a MO2
Synonyms: rab7a SBMO
Target mRNA: rab7a

Morpholino Type: splice blocking morpholino (E2-I2)
Sequence: 5' GCCAACCCTAGAATGGAAGATACAA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 22/25
genome
MO
5' TTGTATCTTCCATTCTAGGGTTGGC 3'
   |||||||||||||||||||||||||
3' AACATAGAAGGTAAGATCCCAACCG 5'
5' TTGTATCTTCCATTCTAGGGTTGGC 3'
   |||||||||||||||||||||||||
3' AACATAGAAGGTAAGATCCCAACCG 5'
5' TTGTGCCTTTCATTCTAGGGTTGGC 3'
   ||||  ||| |||||||||||||||
3' AACATAGAAGGTAAGATCCCAACCG 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr4L:135739074..135739098 25/25 Antisense target rab7a.L
Chr4S:114785888..114785912 22/25 Antisense target rab7a.S
tropicalis 10.0 Chr4:135620751..135620775 25/25 Antisense target rab7a
Publications
First: Rab7 is required for mesoderm patterning and gastrulation in Xenopus., Biol Open 2021                                            
Most recent:
View All Papers