Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-23659299

Morpholino Name: rab7a MO1
Synonyms: rab7a-5′UTR-/TBMO
Target mRNA: rab7a

Morpholino Type: translation blocking morpholino (5' UTR)
Sequence: 5' GTCTCCGCTTCCTACCCCTGCCAGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 24/25 25/25
genome
MO
5' GTTGGCAGGGGTAGGAAGCGGAGAC 3'
   | |||||||||||||||||||||||
3' CGACCGTCCCCATCCTTCGCCTCTG 5'
5' GTTGGCAGGGGTAGGAAGCGGAGAC 3'
   | |||||||||||||||||||||||
3' CGACCGTCCCCATCCTTCGCCTCTG 5'
5' GCTGGCAGGGGTAGGAAGCGGAGAC 3'
   |||||||||||||||||||||||||
3' CGACCGTCCCCATCCTTCGCCTCTG 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr4S:114763359..114763383 25/25 Antisense target rab7a.S
Chr4L:135714993..135715017 24/25 Antisense target rab7a.L
Chr4L:142187967..142187991 21/25 Antisense unknown
Chr6L:21051500..21051524 21/25 Sense unknown
tropicalis 10.0 Chr4:135596563..135596587 24/25 Antisense target rab7a
Chr2:86154152..86154176 21/25 Sense off-target snip1
Publications
First: Rab7 is required for mesoderm patterning and gastrulation in Xenopus., Biol Open 2021                                            
Most recent: FGF-mediated establishment of left-right asymmetry requires Rab7 function in the dorsal mesoderm in Xenopus., Front Cell Dev Biol 2022                    
View All Papers