Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659224

gRNA Name: dnah9 gRNA2
Synonyms:
Genomic Target: dnah9

Sequence: 5' AAACAGGCTGTTGCCTTTCACT 3'



Genomic Target tropicalis
Identities 18/22
genome
gRNA
5' AGTGAAAGGCAACAGCCTTGGC 3'
   ||||||||||||||||||    
3' TCACTTTCCGTTGTCGGACAAA 5'
     
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr2S:62396771..62396792 19/22 Sense off-target tmcc2.S
Chr3L:95527950..95527971 19/22 Sense off-target cpt1b.L
Chr7L:118715439..118715460 19/22 Antisense off-target flt3lg.L
Chr3S:35955651..35955672 19/22 Sense off-target ctdspl2.S
Chr7S:75433074..75433095 19/22 Sense off-target LOC121396482
Chr7L:20441066..20441087 18/22 Antisense off-target ide.L
Chr5L:156980703..156980724 18/22 Sense off-target atad2b.L
Chr9_10L:31792609..31792630 18/22 Antisense off-target LOC108701009
Chr2S:157677349..157677370 21/22 Antisense unknown
Chr4L:63239279..63239300 20/22 Sense unknown
Chr2L:123534517..123534538 19/22 Sense unknown
Chr2L:73712945..73712966 19/22 Antisense unknown
Chr2L:73717779..73717800 19/22 Sense unknown
Chr3S:67874079..67874100 19/22 Antisense unknown
Chr4L:35821599..35821620 19/22 Antisense unknown
Chr4L:35823702..35823723 19/22 Sense unknown
Chr4L:5227711..5227732 19/22 Antisense unknown
Chr5L:168996672..168996693 19/22 Antisense unknown
Chr9_10L:136423856..136423877 19/22 Sense unknown
Chr2S:109416496..109416517 18/22 Sense unknown
Chr5S:66095292..66095313 18/22 Antisense unknown
Chr6L:84785859..84785880 18/22 Antisense unknown
tropicalis 10.0 Chr10:47363946..47363967 18/22 Antisense target dnah9
Chr7:20384587..20384608 20/22 Antisense off-target zranb1
Chr2:110233866..110233887 19/22 Antisense off-target pdcl3
Chr3:89817119..89817140 19/22 Sense off-target cpt1b
Chr2:96952970..96952991 19/22 Antisense unknown
Chr7:86787197..86787218 18/22 Sense unknown
Publications
First: CRISPR/Cas9: An inexpensive, efficient loss of function tool to screen human disease genes in Xenopus., Dev Biol 2015              
Most recent:
View All Papers