Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659223

gRNA Name: dnah9 gRNA1
Synonyms:
Genomic Target: dnah9

Sequence: 5' TAGGAGTGAAAGGCAACAGCCT 3'



Genomic Target tropicalis
Identities 20/22
genome
gRNA
5' AGGCTGTTGCCTTTCACTCCAG 3'
   ||||||||||||||||||||  
3' TCCGACAACGGAAAGTGAGGAT 5'
     
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr7L:20441062..20441083 19/22 Sense off-target ide.L
Chr2S:126507379..126507400 18/22 Sense off-target rb1.S
Chr3L:95527954..95527975 18/22 Antisense off-target cpt1b.L
Chr1L:46852395..46852416 18/22 Antisense off-target LOC108698714
Chr2S:39037139..39037160 18/22 Antisense off-target LOC108709093
Chr2S:39098258..39098279 18/22 Antisense off-target LOC121393110
Chr7S:75433078..75433099 18/22 Antisense off-target LOC121396482
Chr4S:77724879..77724900 19/22 Sense unknown
Chr8S:92447439..92447460 19/22 Sense unknown
Chr2L:123534521..123534542 18/22 Antisense unknown
Chr2S:39014452..39014473 18/22 Antisense unknown
tropicalis 10.0 Chr10:47363942..47363963 20/22 Sense target dnah9
Chr7:20384583..20384604 19/22 Sense off-target zranb1
Chr10:32024847..32024868 18/22 Antisense off-target sdk2
Chr1:134150893..134150914 18/22 Antisense off-target frmd3
Chr3:89817123..89817144 18/22 Antisense off-target cpt1b
Chr1:44628085..44628106 18/22 Antisense off-target slc25a4
Chr3:11650076..11650097 18/22 Sense off-target LOC116409686
Chr1:44628085..44628106 18/22 Antisense off-target LOC100487093
Chr1:122744412..122744433 20/22 Antisense unknown
Chr1:2076922..2076943 20/22 Antisense unknown
Chr1:2112143..2112164 20/22 Antisense unknown
Chr1:2153067..2153088 20/22 Antisense unknown
Chr1:2190160..2190181 20/22 Antisense unknown
Chr1:2223128..2223149 20/22 Antisense unknown
Chr1:2301774..2301795 20/22 Antisense unknown
Chr1:2363262..2363283 20/22 Antisense unknown
Chr1:2406803..2406824 20/22 Antisense unknown
Chr2:109633256..109633277 19/22 Antisense unknown
Publications
First: CRISPR/Cas9: An inexpensive, efficient loss of function tool to screen human disease genes in Xenopus., Dev Biol 2015              
Most recent:
View All Papers