Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659221

gRNA Name: galnt11 gRNA1
Synonyms:
Genomic Target: galnt11

Sequence: 5' TAGGGCCACAATGGGAATCAGC 3'



Genomic Target tropicalis laevis.L
Identities 21/22 20/22
genome
gRNA
5' GCTGATTCCCATTGTGGCCCTT 3'
   ||||||||||||||||||||| 
3' CGACTAAGGGTAACACCGGGAT 5'
5' GCTGATTTCCATTGTGGCCCTT 3'
   ||||||| ||||||||||||| 
3' CGACTAAGGGTAACACCGGGAT 5'
    
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr6L:10700091..10700112 20/22 Sense target galnt11.L
chr6L:10672581..10672602 20/22 Sense unknown
chr8S:96596768..96596789 18/22 Antisense unknown
tropicalis 10.0 Chr6:14675455..14675476 21/22 Sense target galnt11
Chr4:23882402..23882423 19/22 Sense off-target syt7
Chr4:126165902..126165923 18/22 Antisense off-target tlr9
Chr5:92281414..92281435 18/22 Sense off-target rims1
Chr6:4047340..4047361 20/22 Sense unknown
Publications
First: CRISPR/Cas9: An inexpensive, efficient loss of function tool to screen human disease genes in Xenopus., Dev Biol 2015              
Most recent:
View All Papers