Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659217

gRNA Name: tyr gRNA10
Synonyms:
Genomic Target: tyr

Sequence: 5' TAGGAACTGGCCCCTGCAAACATGG 3'



Genomic Target tropicalis
Identities 24/25
genome
gRNA
5' CCATGTTTGCAGGGGCCAGTTCCCA 3'
   ||||||||||||||||||||||| |
3' GGTACAAACGTCCCCGGTCAAGGAT 5'
     
Genomic Alignments Position Identity Strand Target Genomic Target
tropicalis 10.0 Chr2:167828574..167828598 24/25 Sense tyr
Publications
First: CRISPR/Cas9: An inexpensive, efficient loss of function tool to screen human disease genes in Xenopus., Dev Biol 2015              
Most recent:
View All Papers