Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659216

gRNA Name: ccdc40 gRNA2
Synonyms:
Genomic Target: ccdc40

Sequence: 5' AAACCTTCAGCTGTCTCCTCTT 3'



Genomic Target tropicalis laevis.S
Identities 18/22 18/22
genome
gRNA
5' AAGAGGAGACAGCTGAAGAGGA 3'
   ||||||||||||||||||    
3' TTCTCCTCTGTCGACTTCCAAA 5'
5' AAGAGGAGACAGCTGAAGAGGG 3'
   ||||||||||||||||||    
3' TTCTCCTCTGTCGACTTCCAAA 5'
    
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr9_10S:21840617..21840638 18/22 Sense target ccdc40.S
Chr4S:121239074..121239095 19/22 Sense off-target mitf.S
Chr2L:93095241..93095262 19/22 Sense off-target man1c1.L
Chr1L:77578065..77578086 18/22 Antisense off-target tacr3.L
Chr6L:113774718..113774739 18/22 Antisense off-target myom1.L
Chr9_10L:10091477..10091498 18/22 Antisense off-target prex1.L
Chr9_10S:37589367..37589388 18/22 Sense off-target snta1.S
Chr2L:180955908..180955929 18/22 Antisense off-target LOC108707772
Chr8L:9425556..9425577 18/22 Sense off-target LOC121396877
Chr2S:84629375..84629396 19/22 Antisense unknown
Chr5L:104964996..104965017 18/22 Sense unknown
Chr5L:105240932..105240953 18/22 Sense unknown
Chr5S:104959690..104959711 18/22 Antisense unknown
Chr6S:134584320..134584341 18/22 Sense unknown
Chr9_10S:2001897..2001918 18/22 Sense unknown
tropicalis 10.0 Chr10:32820636..32820657 18/22 Sense target ccdc40
Chr10:32884384..32884405 18/22 Sense target ccdc40
Chr6:121342091..121342112 20/22 Sense off-target stau2
Chr8:63247365..63247386 20/22 Sense off-target LOC116406684
Chr2:92603159..92603180 19/22 Antisense off-target bcas3
Chr6:106979148..106979169 18/22 Antisense off-target myom1
Chr8:77534404..77534425 18/22 Sense off-target sipa1l3
Chr10:32754872..32754893 18/22 Sense off-target LOC105945381
Chr10:32792397..32792418 18/22 Sense off-target LOC108648942
Chr10:32792397..32792418 18/22 Sense off-target LOC116407966
Chr10:32754872..32754893 18/22 Sense off-target LOC101731483
Chr2:35297474..35297495 18/22 Antisense unknown
Chr2:35297558..35297579 18/22 Antisense unknown
Chr6:88767126..88767147 18/22 Sense unknown
Chr1:128133581..128133602 18/22 Antisense unknown
Publications
First: CRISPR/Cas9: An inexpensive, efficient loss of function tool to screen human disease genes in Xenopus., Dev Biol 2015              
Most recent:
View All Papers